genotyping service provider (Transnetyx)
Transnetyx is a verified supplier 
Transnetyx manufactures this product 
99
Structured Review
Transnetyx
genotyping service provider
Genotyping Service Provider, supplied by Transnetyx, used in various techniques. Bioz Stars score: 99/100, based on 2179 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/genotyping+service+provider/Automated+Genotyping/pm41413654-345-20-23
Average 99 stars, based on 2179 article reviews
Genotyping Service Provider, supplied by Transnetyx, used in various techniques. Bioz Stars score: 99/100, based on 2179 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/genotyping+service+provider/Automated+Genotyping/pm41413654-345-20-23
Average 99 stars, based on 2179 article reviews
genotyping service provider - by Bioz Stars,
2026-09
99/100 stars
Images
Related Articles
other:Article Title: Targeting CREB remodels the immune microenvironment to enhance immunotherapy responses in pancreatic cancer Article Snippet: Article Title: CREB Drives Acinar to Ductal Cells Reprogramming and Promotes Pancreatic Cancer Progression in Preclinical Models of Alcoholic Pancreatitis Article Snippet: Genotyping was conducted using the automated genotyping service provider, Biomarker Discovery:Article Title: Nucleophosmin supports WNT-driven hyperproliferation and tumor initiation. Article Snippet: .. After successful validation of the mouse strain carrying the Npm1 target allele, genotyping was subsequently carried out by the commercial Article Title: KRAS allelic imbalance drives tumour initiation yet suppresses metastasis in colorectal cancer in vivo. Article Snippet: Correct deletion of the selectable marker was confirmed by PCR across the remaining FRT site, using the oligos for Kras: 5′- ATTCACAGTGTTGTGTGACCATTA G-3’ and 5′- AGTGAGACCTTGTCTTAATGCACTC-3′ (432bp); and for Braf 5′- ACA CTC AGC TTT TTA GTG GGT ACT G-3′ and 5′- TTC CAC CAC TGA AAA TAC TTA AAG G-3′ (486bp). .. Following successful validation of the mouse strains carrying the Kras and Braf conditional alleles, genotyping was subsequently carried out by a commercial Article Title: KRAS allelic imbalance drives tumour initiation yet suppresses metastasis in colorectal cancer in vivo Article Snippet: Correct deletion of the selectable marker was confirmed by PCR across the remaining FRT site, using the oligos for Kras: 5′- ATT CAC AGT GTT GTG TGA CCA TTA G-3’ and 5′- AGT GAG ACC TTG TCT TAA TGC ACT C-3′ (432bp); and for Braf 5′- ACA CTC AGC TTT TTA GTG GGT ACT G-3′ and 5′- TTC CAC CAC TGA AAA TAC TTA AAG G-3′ (486bp). .. Following successful validation of the mouse strains carrying the Kras and Braf conditional alleles, genotyping was subsequently carried out by a commercial Article Title: Nucleophosmin supports WNT-driven hyperproliferation and tumor initiation Article Snippet: .. After successful validation of the mouse strain carrying the Npm1 target allele, genotyping was subsequently carried out by the commercial Article Title: Regulation of ROS signaling by TIGAR induces cancer-modulating responses in the tumor microenvironment Article Snippet: After breeding of chimeras, germline offspring were identified by coat color and the presence of the modified allele was confirmed with PCR using oligos specific for the Tigar cDNA and polyadenylation sequence: 5’ TCCTCCATCACTCCCAACAC 3’ and 5’ GGTTCTTTCCGCCTCAGAAG 3’. .. Following successful validation of the mouse strain carrying the Hprt-LSL-Tigar targeted allele, genotyping was subsequently carried out by a commercial Article Title: Regulation of ROS signaling by TIGAR induces cancer-modulating responses in the tumor microenvironment. Article Snippet: Reactive oxygen species (ROS) in cancer cells can both promote and suppress malignant progression, depending on the tumor type and stage of cancer development.. TIGAR deficiency, which leads to more ROS, increases metastasis in a mouse model of pancreatic cancer, and we show here that overexpression of TIGAR (resulting in less ROS) decreases tumor invasiveness.. We find that ROS levels in the cancer cells impact their interaction with surrounding normal stromal cells, with higher ROS in cancers that have lost TIGAR inducing a more tumor-supportive behavior of surrounding fibroblasts and macrophages. |